Single-cell RNA sequencing has become a common approach to trace developmental processes of cells, however, using exogenous barcodes is more direct than predicting from expression profiles recently, based on that, as gene-editing technology matures, combining this technological method with exogenous barcodes can generate more complex dynamic information for single-cell. In this application note, we introduce an R package: LinTInd for reconstructing a tree from alleles generated by the genome-editing tool known as CRISPR for a moderate time period based on the order in which editing occurs, and for sc-RNA seq, ScarLin can also quantify the similarity between each cluster in three ways.
Via GitHub
devtools::install_github("mana-W/LinTInd")Via Bioconductor
if (!requireNamespace("BiocManager", quietly = TRUE))
    install.packages("BiocManager")
BiocManager::install("LinTInd")library(LinTInd)The input for LinTInd consists three required files:
and an optional file:
data<-paste0(system.file("extdata",package = 'LinTInd'),"/CB_UMI")
fafile<-paste0(system.file("extdata",package = 'LinTInd'),"/V3.fasta")
cutsite<-paste0(system.file("extdata",package = 'LinTInd'),"/V3.cutSites")
celltype<-paste0(system.file("extdata",package = 'LinTInd'),"/celltype.tsv")
data<-read.table(data,sep="\t",header=TRUE)
ref<-ReadFasta(fafile)
cutsite<-read.table(cutsite,col.names = c("indx","start","end"))
celltype<-read.table(celltype,header=TRUE,stringsAsFactors=FALSE)For the sequence file, only the column contain reads’ strings is requeired, the cell barcodes and UMIs are both optional.
head(data,3)##                                   Read.ID
## 1  @A01045:289:HM7K3DRXX:2:2101:9896:1031
## 2 @A01045:289:HM7K3DRXX:2:2101:13367:1031
## 3  @A01045:289:HM7K3DRXX:2:2101:9959:1047
##                                                                                                                                                                                                                                                     Read.Seq
## 1 GAACGCGTAGGATAACATGGCCATCATCAAGGAGTTCTCATGCGCTTCAAGGTGCACATGGTTTATTGGAGCCGTACATGAACTGAGGTTAAGGACAGGATGTCCCAGGCGTAGGTAATTGGCCCCCTGCCCTTCGCCTGGGTTATAAGCTTCGGGTTTAAACGGGCCCTGGGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTC
## 2 GAACGCGTAGGATAACATGGCCATCATCAAGGAGTTCTCATGCGCTTCAAGGTGCACATGGTTTATTGGAGCCGTACATGAACTGAGGTTAAGGACAGGATGTCCCAGGCGTAGGTAATTGGCCCCCTGCCCTTCGCCTGGGTTATAAGCTTCGGGTTTAAACGGGCCCTGGGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTC
## 3 GAACGCGTAGGATAACATGGCCATCATCAAGGAGTTCTCATGCGCTTCAAGGTGCACATGGTTTATTGGAGCCGTACATGAACTGAGGTTAAGGACAGGATGTCCCAGGCGTAGGTAATTGGCCCCCTGCCCTTCGCCTGGGTTATAAGCTTCGGGTTTAAACGGGCCCTGGGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTC
##            Cell.BC        UMI
## 1 GAAGGGTAGCCTCAGC CTTCTCCCGA
## 2 ACCCTCACAAGACTGG TGTAATTTTT
## 3 GAAGGGTAGCCTCAGC CTTCTCCCGAref## $scarfull
## 333-letter DNAString object
## seq: GAACGCGTAGGATAACATGGCCATCATCAAGGAGTT...GGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTcutsite##   indx start end
## 1    0    39 267
## 2    1     1  23
## 3    2    28  50
## 4    3    55  77
## 5    4    82 104
## 6    5   109 131
## 7    6   136 158
## 8    7   163 185head(celltype,3)##            Cell.BC Cell.type
## 1 AAGCGAGTCTTCTGTA         A
## 2 AATCGACTCGTAGTGT         A
## 3 ACATGCAGTCCACACG         AIn the first step, we shold use FindIndel() to alignment and find indels, and the function IndelForm() will help us to generate an array-form string for each read.
scarinfo<-FindIndel(data=data,scarfull=ref,scar=cutsite,indel.coverage="All",type="test",cln=1)
scarinfo<-IndelForm(scarinfo,cln=1)Then for single-cell sequencing, we shold define a final-version of array-form string for each cell use IndelIdents(), there are three method are provided :
For bulk sequencing, in this step, we will generate a “cell barcode” for each read.
cellsinfo<-IndelIdents(scarinfo,method.use="umi.num",cln=1)After define the indels for each cell, we can use IndelPlot() to visualise them.
IndelPlot(cellsinfo = cellsinfo)We can use the function TagProcess() to extract indels for cells/reads. The parameter Cells is optional.
tag<-TagProcess(cellsinfo$info,Cells=celltype)And if the annotation of each cells are provided, we can also use TagDist() to calculate the relationship between each group in three way:
The heatmap of this result will be saved as a pdf file.
tag_dist=TagDist(tag,method = "Jaccard")## Using Cell.type as value column: use value.var to override.## Aggregation function missing: defaulting to lengthtag_dist##           A         B         C         D         E
## A 1.0000000 0.4925373 0.2794118 0.2985075 0.2058824
## B 0.4925373 1.0000000 0.5588235 0.6060606 0.4117647
## C 0.2794118 0.5588235 1.0000000 0.9047619 0.7500000
## D 0.2985075 0.6060606 0.9047619 1.0000000 0.6666667
## E 0.2058824 0.4117647 0.7500000 0.6666667 1.0000000In the laste part, we can use BuildTree() to Generate an array generant tree.
treeinfo<-BuildTree(tag)## Using Cell.num as value column: use value.var to override.Finally, we can use the function PlotTree() to visualise the tree created before.
plotinfo<-PlotTree(treeinfo = treeinfo,data.extract = "TRUE",annotation = "TRUE")## Using tags as id variables## ℹ invalid tbl_tree object. Missing column: parent,node.
## ℹ invalid tbl_tree object. Missing column: parent,node.
## ℹ invalid tbl_tree object. Missing column: parent,node.
## ℹ invalid tbl_tree object. Missing column: parent,node.plotinfo$psessionInfo()## R version 4.5.0 RC (2025-04-04 r88126)
## Platform: x86_64-apple-darwin20
## Running under: macOS Monterey 12.7.6
## 
## Matrix products: default
## BLAS:   /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/lib/libRblas.0.dylib 
## LAPACK: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/lib/libRlapack.dylib;  LAPACK version 3.12.1
## 
## locale:
## [1] C/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8
## 
## time zone: America/New_York
## tzcode source: internal
## 
## attached base packages:
## [1] stats4    parallel  stats     graphics  grDevices utils     datasets 
## [8] methods   base     
## 
## other attached packages:
## [1] LinTInd_1.12.0      S4Vectors_0.46.0    BiocGenerics_0.54.0
## [4] generics_0.1.3      ggplot2_3.5.2      
## 
## loaded via a namespace (and not attached):
##  [1] stringdist_0.9.15       gtable_0.3.6            xfun_0.52              
##  [4] bslib_0.9.0             htmlwidgets_1.6.4       rlist_0.4.6.2          
##  [7] lattice_0.22-7          vctrs_0.6.5             tools_4.5.0            
## [10] yulab.utils_0.2.0       tibble_3.2.1            pkgconfig_2.0.3        
## [13] pheatmap_1.0.12         data.table_1.17.0       ggnewscale_0.5.1       
## [16] ggplotify_0.1.2         RColorBrewer_1.1-3      lifecycle_1.0.4        
## [19] GenomeInfoDbData_1.2.14 stringr_1.5.1           compiler_4.5.0         
## [22] farver_2.1.2            treeio_1.32.0           Biostrings_2.76.0      
## [25] munsell_0.5.1           data.tree_1.1.0         ggtree_3.16.0          
## [28] ggfun_0.1.8             GenomeInfoDb_1.44.0     htmltools_0.5.8.1      
## [31] sass_0.4.10             yaml_2.3.10             lazyeval_0.2.2         
## [34] pillar_1.10.2           crayon_1.5.3            jquerylib_0.1.4        
## [37] tidyr_1.3.1             cachem_1.1.0            nlme_3.1-168           
## [40] tidyselect_1.2.1        aplot_0.2.5             digest_0.6.37          
## [43] stringi_1.8.7           reshape2_1.4.4          dplyr_1.1.4            
## [46] purrr_1.0.4             labeling_0.4.3          cowplot_1.1.3          
## [49] fastmap_1.2.0           grid_4.5.0              colorspace_2.1-1       
## [52] cli_3.6.4               magrittr_2.0.3          patchwork_1.3.0        
## [55] ape_5.8-1               withr_3.0.2             scales_1.3.0           
## [58] UCSC.utils_1.4.0        pwalign_1.4.0           rmarkdown_2.29         
## [61] XVector_0.48.0          httr_1.4.7              networkD3_0.4.1        
## [64] igraph_2.1.4            evaluate_1.0.3          knitr_1.50             
## [67] IRanges_2.42.0          gridGraphics_0.5-1      rlang_1.1.6            
## [70] Rcpp_1.0.14             glue_1.8.0              tidytree_0.4.6         
## [73] jsonlite_2.0.0          plyr_1.8.9              R6_2.6.1               
## [76] fs_1.6.6